EST details — SGN-E207052

Search information 
Request: 207052Match: SGN-E207052
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5007Clone name: cLEC-30-E20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183933 is on microarray TOM1: SGN-S1-1-6.4.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207052Length: 413 bp (790 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E207052 [] (trimmed) GGCTATGGTAATTTCACGAGAGGAAGAAACTCAAGACATAGACGTAGTTTGTTTGGTTCGATATGAGTTAGACCAGGGATCGCACCTTTGAATAA
GAAATCGGAAGTTAGGGTTTGTAGAATGTCGAGTGGAGTGATCCCATCCATCGTTCTGACATTTGGATCTGCGTGGTGGTCTAGTAGGACTGCCA
CCATGTCGGGTGACACCATTTCCGATGCAATGTGGAGGGGGGTTTTGCCAGCTGGACCGGCCGGGTGGTTCACGTTGGCTGCACCGAGCTCGAGT
AACGCTTTCACAACCTCCCGGCTACAATTCTCGACCGCGTAGTGTAACGCGATCGATTCATCGAGATTTAGTCCTTCTCCCATGACCATAAGTTT
GACCAATTCCACGTCGGATGAGTCTAGGGCTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207052] SGN-U601131 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29048 [Download] [View] Facility Assigned ID: TCAEN34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0073 Quality Trim Threshold: 12.5