Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E207781

Search information 
Request: 207781Match: SGN-E207781
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5755Clone name: cLEC-32-O6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173868 is on microarray TOM1: SGN-S1-1-7.1.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173868 [TUS-17-E2] Trace: SGN-T196970 EST: SGN-E395644 Direction: 3' Facility: INRA
Clone: SGN-C173868 [TUS-17-E2] Trace: SGN-T196971 EST: SGN-E395645 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207781Length: 476 bp (829 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207781 [] (trimmed) CAGAGAAAGGGGATTCATGTCGGGCCCGATGGAAAGGAGTTTCACTTCGGGCCCGTTGGAGAATCAGTATGATCCTATACAAATACAAAGGTATA
AACTGAAACCTAAGAAATGGGGTTTGATAAGAAGTTTAAAGAAAGCTTTTTCGAGTTCTTTTTTTGGTTATAAAGAAGTGAAATTTACTGGAAAG
AATATTGTTAATGTTAGTGAAATAAAATTTGTAGATTGGGATAATAATAATGTTGGAAATGTTTTGAGTAGTGAAAATAGCTTGGTTGATGATGA
TGATGATGTAAATGAATCATTTACTGGGCAAAATGTTCAATGGGCACAACGTAAAGCAGGGGAAGACAGAGTACATGTTGTGATTTCTGAGGAAC
ATGGATGGGTTTTTGTTGGGACTTATGATGGATTTAATGGACCTGATGCTACTGATTATCTGGTGAGTTATCTTTATTCAAATGGTTATAAAGAA
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207781] SGN-U585638 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29994 [Download] [View] Facility Assigned ID: TCAEV87THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5