EST details — SGN-E208078

Search information 
Request: 208078Match: SGN-E208078
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6130Clone name: cLEC-34-H19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186630 [TUS-50-H20] Trace: SGN-T351627 EST: SGN-E550752 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208078Length: 583 bp (796 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208078 [] (trimmed) AGCAGTTCGTGAATCAACACTACGAAGCCAACATGAAGAAGCGATTCTATGAATCAGAGCTACCTATGAGCTTAGAAAAGAATGGAAACATCAGC
AACACAGACTGGGAAAGCACATTCTTTGTTTGGCATCGTCCAGCTTCCAATATCTATGAGATTCAAGGTCTCTCGAAGGAACTTTGCAAAGCAGT
AGATGACTATATTGATCAGCTGATCAAACTTGCAGAAAATCTTTCAGAACTAATGTGTGAGAACCTTGGCCTAGCGAAGAGTTACATCAAAGAAG
CATTTTCAGGCAGCAAGGGTCCTTCTGTTGGAACAAAAGTAGCGATATATCCTCAATGTCCCCGCCCAGATTTGGTCAGGGGATTGCGCGAGCAC
ACAGATGCTGGTGGTATCATTCTCTTACTCCAAGACGAACAAGTTCCAGGTCTGGAATTCTTCAAAGATGGGCATTGGGTGAACATTCCACCTTC
AAAGAACAACAGACTTTTTGTAAACATAGGTGATCAAATCGAAATTTTGACCAATGGGATGTATAAGAGTATTCGACACCGAGTGATGGCTGAAA
AGGATGGGAATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208078] SGN-U565391 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30522 [Download] [View] Facility Assigned ID: TCAFE46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5