EST details — SGN-E208183

Search information 
Request: 208183Match: SGN-E208183
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7060Clone name: cLEC-37-K23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208183Length: 318 bp (855 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208183 [] (trimmed) GCAAGCTACAAGATGGCACAGTCTTCATAAAAAAGGGCCACAATGGAGAAAATGAAGACGAGCTTTTCGAGTTTACGACAGATGAGGAGCAAGTT
ATTGATGGGTTGGATAGAGCTGCTATGTCAATGAAGAAGGGTGAAGTGGCACTGCTAATAATTGCACCTGATTATGCCTTCGGTCTATCTGAATC
AAAGCAAGACTTAGGTGTTGTTCCTCCCAACTCAACTGTATATTATGAGGTTGAGCTGGTTTCCTTTGTCAAGGAAAAGGAATCATGGGATATGA
ATACCCAGGAGAAAATTGAGGCCACTGGTAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208183] SGN-U567763 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31174 [Download] [View] Facility Assigned ID: TCAFO72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0177 Quality Trim Threshold: 14.5