EST details — SGN-E208192

Search information 
Request: 208192Match: SGN-E208192
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7134Clone name: cLEC-37-O23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174162 is on microarray TOM1: SGN-S1-1-1.1.16.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174162 [TUS-18-A8] Trace: SGN-T189182 EST: SGN-E376568 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208192Length: 207 bp (853 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208192 [] (trimmed) CAGAAGTAATTNCTTTTCTTCTCTCTCTTATTAAAGAAAAAAAATAATAAGAGGGAGAAAATAAATTTCACATTCAACCATGTTTTCCCTTTCAT
CTATACAATCTAACAATATTCAATCTCAATCATCTTCGTCGCTACTCTTCAATCATCATCACCAGCATTCAACTATTTCAACTCGGTTTCATCAC
CACCGGCTACTCTTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208192] SGN-U570951 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31183 [Download] [View] Facility Assigned ID: TCAFO96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.858 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5