EST details — SGN-E208221

Search information 
Request: 208221Match: SGN-E208221
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7085Clone name: cLEC-37-M10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174136 is on microarray TOM1: SGN-S1-1-3.4.17.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174136 [TUS-17-P6] Trace: SGN-T197166 EST: SGN-E395840 Direction: 3' Facility: INRA
Clone: SGN-C174136 [TUS-17-P6] Trace: SGN-T197167 EST: SGN-E395841 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208221Length: 476 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208221 [] (trimmed) CAGATTAATATTCTCTAGATTTGAATATGGCTTCCAAAACAATTGCAAGTCAGTCTTCAGTACCCCTTTTCCTATCACTGAATCTCCTGTTGTTT
GCTGTTGTAAGTGGAACCAATGATACTGGAAATTGCGTTGGTTCTCAACAAACATGCTCAATAGATACTTTGAAACTTGGTGTGTGTGCTAATAT
ACTTAATTTGGTGAATGTAATAGTCGGGTCTCCACCAACTTTGCCATGCTGCAGTTTGATCCAAGGACTGACGGACCTAGAGGCCGCGGTTTGCT
TGTGCACAGCCATAAAAGCAAATGTGCTGGGAATTAATTTGAATGTACCACTCTCTCTGAGCCTCATACTAAACACATGTGGAAAGAAATATCCT
ACTGGCTTCACTTGTTAAACTACGTATCCTCCACTCTGCCTCATTAATTTCCAAGGGGTTAATAAATAAATAAATAAATGTATCGTCGTGCTTAT
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208221] SGN-U582797 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31212 [Download] [View] Facility Assigned ID: TCAFP77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0214 Quality Trim Threshold: 12.5