EST details — SGN-E208253

Search information 
Request: 208253Match: SGN-E208253
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7106Clone name: cLEC-37-N11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174148 is on microarray TOM1: SGN-S1-1-7.4.17.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174148 [TUS-17-P18] Trace: SGN-T197174 EST: SGN-E395848 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208253Length: 349 bp (763 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208253 [] (trimmed) CCCGGAAAAATTGAACTTTGGAAAATCTCTGTTAGTTCCAAGCGTGCAAGAGCTTGCCAAACAGCACCTAACCATTATTCCAGACAGGTATCTGC
AGCCAGAGCAAGAAACTCCGGTCATTTCCGCCGGAGCGGAGGTTCCAGTTATGGATGTTCAAAAGTTGATTTCAGGTGATTCCATGGATTCTGAG
CTGCAAAAGCTTCACTCTGCTTGCCAACAATGGGGTTTACTACAGGTTATAAACCATGGGGTGACACCTTTGCTCTTGGAGGACTTCAAGAGAGA
GGATATTGAGTTGTTCAAACTTCCAGTGGAAGAAAAGAAGAAGCTGTGGAAACAGGAAGACAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208253] SGN-U565165 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31244 [Download] [View] Facility Assigned ID: TCAFQ78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0286 Quality Trim Threshold: 14.5