EST details — SGN-E208303

Search information 
Request: 208303Match: SGN-E208303
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7119Clone name: cLEC-37-N24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174155 is on microarray TOM1: SGN-S1-1-8.1.16.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174155 [TUS-18-A1] Trace: SGN-T1306 EST: SGN-E378246 Direction: 5' Facility: Giov. Lab
Clone: SGN-C174155 [TUS-18-A1] Trace: SGN-T199843 EST: SGN-E398517 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208303Length: 430 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208303 [] (trimmed) GAGATGGGGAGAGTGGTTTGCTTTTGTTTGAGCAGATGAGAAAACTTAGACGGTTGGAGCCCAATGGGGACACTTTTTCCGTGGTGCTTTCAGCC
TGTGCTAGTAAGGGGTATGTGAAAGAAGGTTTTACGTATTTTGAGCTAATGAAGAATGAATATGGCATTGTTCCTGGAGTTGAGCATTACTTAGG
GATCGCTGATGTTTTGGGAAAATCTGGGCATTTGAATGAATTGCTAGAGTTTATTGAAGACATGCCTATTGAGCCTACAAAAGTAGTATGGGAGG
CCGTGATAAATTTTGCACGAATTCATGGGGATATTGAACTTGAAGATCGAACGGAGGAGCTGCTCATTATGTTAGATTCTTCCAGAAATATGGCT
GATAAGCCGGTTGCACCATTTCAGAAAAGGCATTCTGAGTTTAATATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208303] SGN-U581772 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31294 [Download] [View] Facility Assigned ID: TCAFR84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5