EST details — SGN-E208515

Search information 
Request: 208515Match: SGN-E208515
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7593Clone name: cLEC-39-I16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208515Length: 364 bp (1082 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208515 [] (trimmed) GCCAGGTGGCAATCCACTCACCAAATTATTAGCAACTGGAATTGCAGACTATGAGGCAGATAAATGGGCTGTACATAGAAGGCTTCTCAATCCTG
CTTTTCACCTTGACAAGTTGAAGCATATGCTACCTGCATTTAAATTGACTGGTAATGAGATGTTGAGCAAATGGGAGAAAATTGTGTCTAGAGAA
GGATCAGAGATAGATGTGTTGCCATATCTACAAACTTTGACAAGTGATGCAATTTCAAGAACTGCTTTTGGTAGTAGCTACGAAGAAGGAATAAA
GATTTTTGAACTTCAAAAAGAACAAATTCAACTAATTTTAGAAGTGTCACGCACGATATATATTCCAGGATGGAGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208515] SGN-U578818 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31805 [Download] [View] Facility Assigned ID: TCAFX56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5