EST details — SGN-E208570

Search information 
Request: 208570Match: SGN-E208570
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7544Clone name: cLEC-39-F22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168631 [TUS-3-J21] Trace: SGN-T736 EST: SGN-E379400 Direction: 5' Facility: Avesthagen
Clone: SGN-C168631 [TUS-3-J21] Trace: SGN-T1046 EST: SGN-E380065 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208570Length: 501 bp (712 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208570 [] (trimmed) CAGATCTTCTACTTCTTTATCTCAAATTTCTCAGCTGACTGCATATTGAAAATCCTGAATCTCATCATTGTTGAAGACTTGCGAGTTTTCTCATG
TCAACTCCATTAGTTGTTGGAACTACCATTGGTGCTGCTGCTTTGGGAGCTAGATACTTGATAAGAGCGTGGCAAAGGTTCAAAGCAGCACCCCG
AGTGAGGAGGTTTTATCCTGGGGGCTTTGATCGGGATATGACACGGCGAGAAGCAGCATTGATTCTCGGAGTTAGGGAAAGTGCTGTCTTGCAGA
AGATCAAGGAGGCTCACAGGAGAGTAATGGTAGCAAATCATCCAGACGCCGGTGGCAGCCATTATCTTGCTTCCAAGATCAATGAAGCCAAGGAC
GTGTTGTTAGGGAAAACCAAGGGAGCTAATTCTGCATTTTAATTGACCAGTGTGTTCTTTACGCTGCGAATTCTTAACAGCTTCATGATAGTCAA
CATTAAAATGGATCTTTTTCTGGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208570] SGN-U573193 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31860 [Download] [View] Facility Assigned ID: TCAFZ35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5