Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E209288

Search information 
Request: 209288Match: SGN-E209288
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C8840Clone name: cLEC-53-H11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186716 [TUS-50-L10] Trace: SGN-T351662 EST: SGN-E550787 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209288Length: 489 bp (670 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209288 [] (trimmed) CACGAGGATAGGGCTGGAACATATTTGTACCTTGCTCATTATGGTATGCAAAGACAAGCAGGACTACAAGGAATGATGAGAGTATCATTACCTGA
TGGAGTTTTAGAGCCATTTTCATATGATCATGATAGGAGTATTCTTCTCACTGATTGGTACCACAAGAGCACTTATGAACAAGCAACTGGTCTTG
CTTCATTGCCTTTTTCTTGGGTTGGAGAACCTCAGGTAAAAAATACTATATGTACAACTTATTTCAATTCGTTTGTCTTATTTTGACTTAACATG
GAATTTTTAATTTGTTTCTTTTTTTTCAGTCAATCTTGATTCATGGAAGAGGAAGATTCAATTGTTCTATTCCGACCATAGATCCTACTCTTTGT
AATGCTACAAATCCTCAATGTACACCTTATTCAATGACTGTGGTTCCTGGCAAGACTTATAGGCTTAGAATTGGCAGCTTGACTGCTCTTTCAGC
TCTAAGTTTTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209288] SGN-U595446 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T33070 [Download] [View] Facility Assigned ID: TCAIC42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5