EST details — SGN-E209965

Search information 
Request: 209965Match: SGN-E209965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7871Clone name: cLEC-40-I21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174303 is on microarray TOM1: SGN-S1-1-4.3.16.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209965Length: 639 bp (885 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209965 [] (trimmed) CAACTTTTTCGACCACGTATCCCACCCCCGCCCCCAACCACCACAGAACAGCACAGCCACCCCAATTTCAATTTACGATCTTCAGTTCCATTTGA
ACAATAGAAGGACAAGAACCGATCAAACCAACAACCTGATGTCTGAGTTTAATAATTCCTTAATTTTTGATACTACTACTGGTAGTATTACTTTC
CCACCGACATCACAGCAACACGACGCCGGTGATGGAAATGTAAGTGCTATTACTGTTACCGAACAGTCGGCAGGTGCAGCGGATCCATCAATTGC
CGAACAGGCACGGAATCCGAAGAAAAGATCGAGAGCTTCTAGGAAGGCACCAACTACTGTGTTGACAACAGATGCAAATAATTTCAGAGCTATGG
TTCAAGAATTTACAGGGATTCCAGGACCACCCTTTGCTGCTCCTCCTATTATCCCTATTCGAAACAGATTTGATTTGTTTCCTACTGTGCCTAAT
TCTGTTGCTCCTACTCCTATCGCCAATAATAATACTTTCCTCATTTCACAACCATCGCCTAATTATCTACAAAGGCCTTTTCCTCAGACAATTCA
GCCGCCACCACCCTATCTTGGTCCTTCTTCATCGTCAGCGTCTGCGTTCAATCGTTTACCTATCAACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209965] SGN-U568669 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32029 [Download] [View] Facility Assigned ID: TCAGA59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5