EST details — SGN-E209986

Search information 
Request: 209986Match: SGN-E209986
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7868Clone name: cLEC-40-I18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174302 is on microarray TOM1: SGN-S1-1-5.3.16.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174302 [TUS-18-G4] Trace: SGN-T189254 EST: SGN-E376640 Direction: 3' Facility: INRA
Clone: SGN-C174302 [TUS-18-G4] Trace: SGN-T189255 EST: SGN-E376641 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209986Length: 547 bp (661 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E209986 [] (trimmed) CAGGCAGTGTTGAGTCGCGCCCTTTTGCAGCTATCTGTTTCTGCAATCGAGCTGCTGCTCACCAAGCTCTTGGTCAAATTGTTGATGCCATAGCA
GATTGCAGTCTTGCCATTGCTCTTGACAAGAACTACACGAAGGCTGTTTCAAGGAGGGCTACCTTACATGAGATGATTAGAGACTATGGGCATGC
TGTAAATGATCTTGAGAGGCTCATATCCCTTCAGGAAGCTCAATCTCAAGAAAGGATTCGACAATCTGAGGCGCTGGATAAGTCAAATGGAAGTA
GTGCTAAAGAAGCAAAGCGAACTCGTCGGCAGCTTTCGACAATTCAGGAGAAGGCTAAAAGAGCAACGCCATTGGATCTTTATCTTATTTTGGGA
ATCAAGTCATCTGATACAGAATCTGACATCAAGAAGGCATATAGGAAAGCAGCCCTCAGACATCATCCTGATAAGGCGGGTCAAATTTTGGCAAG
GAGTGATGCCATGGATGATGGAGGGTTGTGGAAAGAGATCTCTGATACTGTCCGCAATGATGCTGATAGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209986] SGN-U572964 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32050 [Download] [View] Facility Assigned ID: TCAGB57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5