EST details — SGN-E210159

Search information 
Request: 210159Match: SGN-E210159
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7887Clone name: cLEC-40-J16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174308 is on microarray TOM1: SGN-S1-1-7.3.16.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174308 [TUS-18-G10] Trace: SGN-T189197 EST: SGN-E376583 Direction: 3' Facility: INRA
Clone: SGN-C174308 [TUS-18-G10] Trace: SGN-T189198 EST: SGN-E376584 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210159Length: 558 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210159 [] (trimmed) AAGCTTAGGAGTATCCCTTAGAATTCTCCTATAAATTCGCCTTTTTTCTGTAAATTTTACTCATATATTCTCTACAGCCTTTTCCTTTTTCTTAA
ATTTACAAAAGATTTTACTTCTTCAATTACCTGCAAAACACACCGGAAAAATGTGTCCCACCGGAAGTGTTTTGCATTCTGCCGCCGGCGCCGGA
AAACCAAATCTGCGGTCAGCATTCGACGTTTTGGACGTTGACCGCGATGGAAAGATTAGCAGAGAAGATCTACGAACATCGTACGGTGGATTCGT
CGGCGACGATATGATTGGTACGATGATGACGGTGGCGGATTCGAACGAAGATGGATACGTTGAATTTGAGGATTTCGAGAAGGTTTTGGATAGTT
CTATTAGCAGAAACAGCGAGGAGAAGAGGAAAAACGGAGCATTACGAGGAGAAATGAATGTAATGGAGGATGTCTTCAAGGTGATTGACAAAGAT
GGAGATGGTAAAGTTGGGGTTGAGGATTTGAAAAGTTATTTGAGTGGGGCTGGGCTTCAAGTTGATGATGATGATATCAAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210159] SGN-U576468 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32223 [Download] [View] Facility Assigned ID: TCAGD56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5