Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E210193

Search information 
Request: 210193Match: SGN-E210193
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7958Clone name: cLEC-40-M9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174324 is on microarray TOM1: SGN-S1-1-7.4.16.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174324 [TUS-18-H2] Trace: SGN-T197333 EST: SGN-E396007 Direction: 3' Facility: INRA
Clone: SGN-C174324 [TUS-18-H2] Trace: SGN-T197334 EST: SGN-E396008 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210193Length: 663 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210193 [] (trimmed) CAGCAACAACACCCTCCACATTTTGGAGAGTTTCCAAGGGGTCCACAACCTCTGCCAGGTCCACCACCCATGATGCGGCAGCCATCTGCATCCTC
CACTACTCTTAACTCTCAGCTACCTGGACCTCCTCCTCATCCTTCTTATGACGCTCATGCTGACAGTTTTGCTGCAAAGAGAATGAGAAAAATTG
GCCAGAGAAGAGCAGTTGACTACACCAGTACAGTTGTAAGATATATGCAGATCCGCATGTGGCAGCGCGATTCAAGGGATAGGACAGTGTTACAA
CCGAGCCCAGCAGCAGCAGTTGATATATTGCCAGCAGTTGCCTATTTGGATAATCCATCTACAAGTTTTGCTGCTAAATTTGTTCATACATCTCT
AAATAAAAACCGTTGTTCAATCAATTGTCTTGCGTGGACTCCTAGTGGGCGGCGCCTTGTTACTGGATCTCAAAGTGGTGAATTCACACTATGGA
ATGGGCAATCATTTAACTTTGAAATGATTCTTCAGGCTCATGATCAAGCAGTCAGGTCAATGGTATGGAGCCACAATGATAACTGGATGGTCACT
GGTGATGACGGGGGCACAATAAAGTATTGGCAAAACAATATGAATAATGTCAAAGCCCATAAGAATGCACATAAAGAATCAATACGGGAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210193] SGN-U576241 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32257 [Download] [View] Facility Assigned ID: TCAGA77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5