EST details — SGN-E210234

Search information 
Request: 210234Match: SGN-E210234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7851Clone name: cLEC-40-H22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183944 is on microarray TOM1: SGN-S1-1-3.4.18.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183944 [TUS-43-H22] Trace: SGN-T197961 EST: SGN-E396635 Direction: 5' Facility: INRA
Clone: SGN-C183944 [TUS-43-H22] Trace: SGN-T198113 EST: SGN-E396787 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210234Length: 459 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210234 [] (trimmed) GTTAATTACGATAAATTTATAAAGCATATCTACAATGGCTGTTTACAAAGTTAGTTTCCTTGCTCACCTACTTGTTCTTGGAATGTATCTACTAG
TAAGCACGGTGGAACACGCTAATGCTTGTACTAAAGAATGTGGTAATCTTGGCTATGGGATATGCCCAGGTTCAGAAGGAAGTCCAGAAAATCCA
ATATGTACCAATTGTTGCTCTGGCTATAAGGGTTGCAACTATTATAACGCTAATGGAACTTTTATTTGTGAAGGAACGTCTGATCCAAAAAATCC
TAACATTTGCCCCTCATATTGTGATCCACAAATTGCCTATTCAAAGTGTCCACGTTCAGAAGGAAAGACGATAATCTATCCCACAGGATGTACGA
CGTGTTGCACTGGTTACAAGGGTTGCTACTATTTTGGTCAAGATGGAGAGTTTGTGTGTGAAGGAGAGAGTATTGAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210234] SGN-U578841 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32298 [Download] [View] Facility Assigned ID: TCAGD47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0065 Quality Trim Threshold: 12.5