EST details — SGN-E210282

Search information 
Request: 210282Match: SGN-E210282
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6563Clone name: cLEC-35-M9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174007 is on microarray TOM1: SGN-S1-1-4.2.17.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174007 [TUS-17-J21] Trace: SGN-T189087 EST: SGN-E376473 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210282Length: 285 bp (2011 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210282 [] (trimmed) TGATGTTAAGTTGATTGGTTTATGGTATAGTCCTTTTAGTAGAAGAGTTGAATGGGCTCTAAAGATTAAGGGTGTGGAATATGAATATATAGAAG
ATGATCTACATAATAAAAGCCTTTTACTTCTTCAATCTAATCCAATTCACAAGGCAGTTCCTGTGCTCATTCACAATGGCAAGCCCCTTTGTGAA
TCAAGTGTCATTCTCGAATACATCGACGAGACATTTGAAGGCCCTTCCATCTTGCCTAAAGAACCTTACGATCGATCTTTAGCTCGTTTCTGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210282] SGN-U577816 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30630 [Download] [View] Facility Assigned ID: TCAFG77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0196 Quality Trim Threshold: 14.5