EST details — SGN-E210371

Search information 
Request: 210371Match: SGN-E210371
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6364Clone name: cLEC-35-D2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173910 is on microarray TOM1: SGN-S1-1-5.2.17.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210371Length: 351 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E210371 [] (trimmed) CTCTTTCAGTTTTAGCTTTTTCTATATCTATATATAAAACACTGCTACCCGATAAAGAAGATAAAACAGAGTTAAGAAAACATGCCTGCAAGTTT
AGACCCTTTGGATGTTGGTGTTCAGATTCCATACCATTTTCGGTGTCCAATCTCCTTAGAGCTTATGCGAGATCCGGTCACAGTCTGTACCGGTC
AAACTTACGACCGCCAAAGCATTGAGTCCTGGGTCGCCACCGGCAATACTACTTGTCCGGTAACAAGGGCGCCGCTCAGTGATTTCACTCTTATT
CCAAATCATACTCTTCGCCGCCTTATACAGGAGTGGTGTGTTGCGAACCGGGCTTTCGGAGTTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210371] SGN-U571565 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30719 [Download] [View] Facility Assigned ID: TCAFJ13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5