EST details — SGN-E210429

Search information 
Request: 210429Match: SGN-E210429
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6430Clone name: cLEC-35-G19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173939 is on microarray TOM1: SGN-S1-1-8.4.18.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173939 [TUS-17-H1] Trace: SGN-T189068 EST: SGN-E376454 Direction: 3' Facility: INRA
Clone: SGN-C173939 [TUS-17-H1] Trace: SGN-T189069 EST: SGN-E376455 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210429Length: 468 bp (1876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210429 [] (trimmed) GAAAAATCATCAGTTTTGGAGAAGGAAACTTGAATTGCAATCCAATTTTGTGAAAAAGAAAAATGGAGTGTGTTTTGGCTCATGAGAAAGATTTG
AATCTCAAGGCAACAGAGCTTAGATTGGGTTTACCAGGGAGGACAGATGAAGAATCTGACAAAGAAATTGTATTTCATTTCAAGAATAACAAGAG
GGCTTTGCCTGAGGATGAAGATTGTGAATCAAACTCCATTTCAGATCCCAAAACTCCACCTGTTGCCAAGACACAAATAGTAGGGTGGCCACCAG
TAAGAGCTAACAGGAAAAATAGCTTTCCATCAAAGAAAGCAGAAGCTGAATGTGGGATGTATGTGAAAGTTAGTATGGATGGAGCCCCTTATCTT
AGAAAAATTGATCTGAAATTGTACAAGGGTTATCCAGAACTGTTGAAGGCATTAGAGAAAATGTTCAAGCTGAGTATCGGTGAATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210429] SGN-U579749 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30777 [Download] [View] Facility Assigned ID: TCAFG46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5