Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E211253

Search information 
Request: 211253Match: SGN-E211253
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11224Clone name: cLEC-70-N12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E211253Length: 670 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E211253 [] (trimmed) ATGGATTTGTCTTTTAACAAGCTTTATGGTCCGCTCCTTCCTTGTTTGGGTAACTTCAAGCTAGCAGAAAATGATGCAGAAACAAGAAGTGTATA
TTATCAAGCATCTTCCAGGTTAGCTTGGTTAGATTTCAAGAGTTGGATAAGTTCAACAAGGCACTACCACATTTCATATGGATTTCTAAGTGACT
TCAATTTGATGGATGTGGAAACCCGAGTTCAGTTTTCAACAAAACGAAATTCGTACACTTACAAGGGAAGCATTCTAAAATATATGTCGGGTATT
GATCTCTCAAGTAACAGATTAACGGGTATAATTCCTGTTGAGCTAGGGAACCTGAGCAAAATACGAGCATTTAATCTATCGCACAACCATATCTT
TGGAAGAATCCCATATACCTTCTCAAATTTACATGAAATCGAGAGTCTGGACCTATCCCACAACAGCTTGAATGGGACAATTCCTGTTGACCTAC
TTGAGCTACACTTTTTGGCAATATTCAGCGTAGCATACAATAACTTATCTGGTGCAGTACCACCATTTAAAGCTCAATTCTCAACTTTCGACAAA
AGCAGCTATCAGGGGAATCCTTTACTATGTGGTTATCCATTAGACGAGTGTTACGGTACTAAATCATCAAACACCTCAAACAATGGAAATGANGA
ATCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E211253] SGN-U569716 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T34602 [Download] [View] Facility Assigned ID: TCAKT78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5