EST details — SGN-E211935

Search information 
Request: 211935Match: SGN-E211935
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C9599Clone name: cLEC-66-G6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186755 [TUS-50-N1] Trace: SGN-T351692 EST: SGN-E550817 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E211935Length: 629 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E211935 [] (trimmed) CCGTCTCCGCTTTGGTTATGGCTAATATTAACGTAACGGGGTGTATACCATCAAGTATAGCAAAAATGTCGAAAACATTGAATGAAATTATTCTC
TCGAATTCGAGTTTAAGTGGATGTTTGCCTCAAGAATTAGGGTTATTGAAAAATGTTAGGGTTCTTGATGTGAGTTTTAACAAGCTTGTTGGTGA
GTTACCGGAATCAATTGGTGAAATGAAGAAATTGGAACATCTTAACGTGGCACAAAACAAGTTTTCCGGCAAGATTCCGATGAGTATTTGTTTAT
TACCAAAGTTGGAGAATTTTACTTATTCTTATAATTATTTTTGTGGCGAACCAAAGATTTGTCTCAAGTTGAAGGATATAAATGATAAGAAAAAT
TGTATACCATATCGACCATCACAACGTTCAGAAAATGAATGTAAGGCATTTTATTCGCGAGGTCCGGTGAATTGTAGTTCATTTGGTTGTAGATC
ACCACCACCGCCACCTCCACCACCACCGCCGCCACCTCCTCCACCACCACCGCCGCCGCCGCCGCCGCCACCACCAAAAGCACATTATTATCATT
ATCCGTAAGTGGTTGAGGAGTTGTGTTTATTTGACTTTTGTTGGGGTTATGTGATTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E211935] SGN-U575357 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T33471 [Download] [View] Facility Assigned ID: TCAKB39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5