Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E211945

Search information 
Request: 211945Match: SGN-E211945
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C9677Clone name: cLEC-66-K2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
See unigene SGN-U565313 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C186768 [TUS-50-N14] Trace: SGN-T351689 EST: SGN-E550814 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E211945Length: 658 bp (886 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E211945 [] (trimmed) CCACCCGCACGAGCTTAACAGTGTGCTATTCTGGTCCGTCTTTGTGAGTTGCTTCGTGTAAACACAAAATGGTTTCTGTTGAAAGATTAAAACAG
TTCTCATGCATACCATCAGAAGCTGAGTGGCGAAAAAGGGATTTTGTCCCACCTTCAGATTGGCCGAACCATGGCAATGTTGAGCTTGAAGACTT
ACAAGTTAGGTATCGTCCAAATACTCCTCTAGTGCTTAAAGGAATTACTCTCAACATTAGAGGGGGAGAGAAGATCGGTGTTGTTGGTCGTACTG
GAGGTGGAAAATCAACACTTATTCAAGTTTTCTTCCGTTTGGTGGAGCCTGCAGCTGGAAGAATAGTCATTGACGGCATTGACATATCCAGGCTC
GGGCTTCATGATCTTAGATCTCGCTTTGGGATCATTCCTCAAGAACCAGTTCTTTTTGAAGGAACTGTGAGAAGCAACATTGACCCCATTGGACA
ATATTCAGATGATGAAATTTGGAAGAGCCTCGATCGCTGCCAACTGAAAGAAGTGGTGTCTTCAAAACCCGAAAAGCTTGACTCACCAGTTGTTG
ATAATGGAGACAACTGGAGTGTTGGGCAGAGGCAGCTTCTTTGCTTANGAAGAGTGATGCTAAAACGAAGCAGACTTCTATTTATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E211945] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T33481 [Download] [View] Facility Assigned ID: TCAKB61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5