EST details — SGN-E213706

Search information 
Request: 213706Match: SGN-E213706
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C13124Clone name: cLEC-76-P5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E213706Length: 709 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E213706 [] (trimmed) GTTTTGTGTAAAATCCAAAAAAATGTATGGAACCCATAGCAAGAGAGACATGGAGATTGAATATCAATCTCAAGTTCCAATTTTGAGGCCAAGTA
TACATGCCAGAAGGGCAAAGATTACTGTGAAATTTCAAGATCTGTATGGATTTACTGTTGAAGGGAATGTTGATGATGTTAATGTGTTGAATGAG
GTTAGGGAGAAAGTTAGGGAACAAGGGAAAGTTTGGTGGTCATTAGAAGCTAGCAAAGGTGCTAATTGGTATTTGCAAACTCATGTTTCCTCAAC
CCTTAAAACATCCCTCAAATTCTCTGCTTTGGTGAATGCAATTACTCTCAAGAAGCTCATTAGAAAAGGAATTCCACCTGTTTTGAGGCCTAAGG
TGTGGTTTTCACTATCAGGAGCTGCTAAGAAGAAATCGACTGCCCCGGATAGTTATTATGAGGATTTGACAAAGGCTGTACAGGATAAGGTCACA
CCTGCAACCAAGCAGATTGATCATGACCTTCCACGAACCTTTCCTGGTCACCCCTGGTTGGACACTGCTGAGGGTCATGCTGCCCTTAGGCGGGT
CCTTGTTGCCTATTCTTTCCGTGATTCTGATGTTGGCTACTGCCAGGGATTAAACTATGTTGCAGCATTATTATTGCTGGTGATGAAAACCGAAG
AAGAGCTTTCTGGATGATTGCTGTCCTTCTAGAGAATGTGGTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E213706] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T36365 [Download] [View] Facility Assigned ID: TCALQ87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5