EST details — SGN-E214518

Search information 
Request: 214518Match: SGN-E214518
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C13944Clone name: cLEC-79-G1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E214518Length: 382 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E214518 [] (trimmed) GGAAAGCAAACAAGTCAAGAGAACCTATTATTCCAAAGAAAGATTTACCTGAGGTGAGTCCTGAAGCAAAGAAGAAAGCTGCAGATGCAAAGGCG
AGGGCAGACGAGGCATTTAATAGGAAAGATTTTGCTACAGCTATAGATACTTACACGCAGGCAATCGATTTTGATCCAACTGATGGCACTCTGTT
TTCCAATAGAAGTCTTTGTTGGCTCCGCCTGGGCCAAGCTGAACGCGCCTTAAGTGATGCCAGGGCCTGCAGAGAACTTAGACCAGATTGGGGCA
AAGGTTGTTATCGGGAAGGTGCAGCTCTACGTCTATTGCAGAGGGTTGAAGAGGCAGCCAATGCTTTCTATGAGGGTGTACAGATCACCCCTGAT
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E214518] SGN-U578144 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T36940 [Download] [View] Facility Assigned ID: TCAMA37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0207 Quality Trim Threshold: 12.5