EST details — SGN-E214811

Search information 
Request: 214811Match: SGN-E214811
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C13938Clone name: cLEC-79-F4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E214811Length: 635 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E214811 [] (trimmed) GTCTGACCTGACGTGTGACAGTGATGGAAAGGTTGATAAGTTCATTGGGGGCGAATCAAGCTTGCCGCTCCATGAAATTGGAAGTGGTGATGGTG
GGCGGTATTATCTGGGGATGTTTTTGGGTGGGGCTTATGAGGAGGCGCTCGGAGGACTCCACAATCTATTTGGTGGACCAAGCGTTGTTCGGGTG
ATGCAGAGCGATAGCCCTCACAGCTTTGCGGTGACTCGCTCTGTCCCTGGTCCATCGTGTGCTGATGTGCTCCGGGCGATGCAGTTTGAGCCTGA
ACTCATGTTCGAGACTCTCAAGCACCGTGCAGAGGAATTCTTGGAACAAGGAGAAGGAGAAGGCGAAGGTGTTGCCTTTGGATCTTTGACCAGCA
GCTTAGCTCAGTCCTTCCACAACATGCCTTACCTTTCGTCTTGCTGCTTCACTGCAGAAGCCACTGCCAATGCCAATACCAATACCAATAATGGT
GGCTATTACTATTACAGTGAAGACAATGCTGCAGCAGAGGAAGATGAGATTTGGTCCTACTAAACTCTGCTTGAAGTGTCTCTTGTTAGCATCTC
CAGTTTGTTTTAGTTTGTGGTCGAGGTCGTCTGTTTTTTTATAATAATCCCACCCCNTAGTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E214811] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T37233 [Download] [View] Facility Assigned ID: TCAMD26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0141 Quality Trim Threshold: 12.5