| SGN ID: SGN-C51915 | Clone name: cLEL-15-G17 |  | Order Clone |
|
| Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
See unigene
SGN-U576603 for alternative clones/ESTs which are mapped
| Sequence Id: SGN-E215605 | Length: 256 bp (734 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E215605 [] (trimmed)
ATCTTGCCCACCAGAATTTTTCATTTCAGTCTAAAATAAAATCCACCCCATAAAGATACATCAAACAACTCTCCATACATAAGTCAGCTTCATAA
CTAAGTGTTTGCATATGAAACTCATCCATGTTCCCGGACGGAATGCACACATATATACATGGGGAGATATATTGTCAGTTACACATAACATGTAG
ATCAAACCTGCAACAATCTGTCAGCAATTATTCACATGCGCTGGTATTCAGGATTAAATGCAATCG
[BLAST] [AA Translate]
| SGN-ID: SGN-T5998 [Download] [View] |
Facility Assigned ID: cC-esflcLEL15G17d1
|
| Submitter: Koni |
Sequencing Facility: Cereon |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.919 |
Expected Error Rate: 0.0287 |
Quality Trim Threshold: 14.5 |
