Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E216088

Search information 
Request: 216088Match: SGN-E216088
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51088Clone name: cLEL-13-C18
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216088Length: 230 bp (594 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E216088 [] (trimmed) AGGTCTTGGAAACTTGATTGAAATTCGAATTAATCATACCCGGAATAAAAAGATGGAAAACAAGGGAAAATGAATACAATTTTTCAAGGGAAAAC
CCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTTTAGAACTTAGTATCCTTCGGGCTTGTAAGCGATGAAACTGA
TGCACTGGACTTGACGAACTCTCTCTCTCTCTCTCTCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216088] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T4849 [Download] [View] Facility Assigned ID: cC-esflcLEL13C18a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0