EST details — SGN-E216151

Search information 
Request: 216151Match: SGN-E216151
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51367Clone name: cLEL-13-O1
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C51367 [cLEL-13-O1] Trace: SGN-T5057 EST: SGN-E216296 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216151Length: 408 bp (999 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E216151 [] (trimmed) CCAAGTAAACGATCTATATTAGCTTTCAAAAATAAATGGCACAACAAATGTTAGCGCCAAGTGCTAACTCACATCTTTATGACAAACAAAAAAAT
TCAATCTTCCTCAACAGTTATAAAGCTGGCTAGATTGCTTACAGCAGCTATATCTCGAACAAAATCATTACTGCGCAACATTACTCTCATTAGAC
TTGATATCACCGAGTTCGACTTTAGCCAAACCAAGCTCCTCCTCTATCTTGGTCCAAACTTTCACCACATTAGCAGGGAACTTCTTCTTCATTGT
CCTGATCATTGCTTTTGCTTCTTTCGCCTTTGAACTCTTCGCGCAAACCATGAACCAAGTACTTGAGTGTATTGACATCCGGAATCTTGTTTGCT
CTCACACTNTCTCTGAACACTTTATACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216151] SGN-U581900 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T4912 [Download] [View] Facility Assigned ID: cC-esflcLEL13O01a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0178 Quality Trim Threshold: 14.5