Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E216510

Search information 
Request: 216510Match: SGN-E216510
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53628Clone name: cLEL-1-A14
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53628 [cLEL-1-A14] Trace: SGN-T2506 EST: SGN-E216990 Direction: 3' Facility: Cereon
Clone: SGN-C53628 [cLEL-1-A14] Trace: SGN-T20674 EST: SGN-E281266 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216510Length: 486 bp (724 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E216510 [] (trimmed) TTTTTTTAAGTTCTTGGTATCTGATAGTTTCCCTGGAAATGAAAGGACCAAATACTGTCTAACATCCAAGATACCGTTGGGTGTGATTCTGGCGA
TTCCTCCTTTCAACTATCCGGTCAATCTTGCCGTCTCCAAGATTGCTCCTGCACTGATTGCTGGAAACTCTTTAGTCCTCAAGCCTCCAACTCAG
GGTGCTGTGGCTGCCCTGCATATGGTGCATTGCTTCCACTTAGCTGGATTCCCTAAAGGCCTTATCAGTTGTGTGACCGGAAAAGGTTCTGAAAT
CGGAGATTTTCTCACTATGCATCCTGGAGTAAACTGTATAAGCTTCACTGGTGGAGACACCGGTGTTGCAATCTCGAAGAAAGCAGGAATGGTCC
CTCTACAGATGGAGCTGGGAGGAAAGGATGCTTGTATCGTGCTCGAGGATGCTGATTTAGATTTGGCTGCTGGAAACATTGTGAAAGGAGGATTT
TTTTACAGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216510] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T2026 [Download] [View] Facility Assigned ID: cC-esflcLEL1A14b1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5