Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E216696

Search information 
Request: 216696Match: SGN-E216696
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C54005Clone name: cLEL-1-P8
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C54005 [cLEL-1-P8] Trace: SGN-T20927 EST: SGN-E281595 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216696Length: 410 bp (566 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E216696 [] (trimmed) CTAGGTGGTTTTTCAGGTCATTAAAATACATTTAAAGCAAATCAGAACAGAGAGGGCACAATAGAGTGGCCTACGACAAAGGTGCTGTGTGACTA
AACAATTAGAGATCACAGCCATTACACAGAAAACCGAGCCACCTGACAATTCAAGAGATCACTAGTAATTTTAAATGAGACATACAACATGGACC
TCCTACTTCCTCCGAGACAAATGACAAAGGAATACGAGAGAGAGGTTACAAGGAGAAGTGTGACCAGTAATAACATTGGACCTACTGTTGATCAC
AAAATAGAACATGCCTTTTGGGACTTCCCCTTCTTTTTCTTCTGCTTGGGTGGCTGGAGCACGACCTTGATAGCGGCATCAAAGACTGCTTTCAC
GTTCTGCTGTGTTTTTGAACTACATTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216696] SGN-U581579 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T2212 [Download] [View] Facility Assigned ID: cC-esflcLEL1P08a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0093 Quality Trim Threshold: 20.5