EST details — SGN-E216784

Search information 
Request: 216784Match: SGN-E216784
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53979Clone name: cLEL-1-O6
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53979 [cLEL-1-O6] Trace: SGN-T2378 EST: SGN-E216862 Direction: 3' Facility: Cereon
Clone: SGN-C53979 [cLEL-1-O6] Trace: SGN-T20738 EST: SGN-E281500 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E216784Length: 422 bp (641 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E216784 [] (trimmed) TTTTTTGCTATAATTTCATCAGAAAAATGTTAGGCAGAGGTAAGGGAGGCAAAGGATTGGGCAATGGAGGAGCCAAGAGGCACAGGAAAGTGTTG
AGAGACAACATTCAAGGAATTACAAAGCCAGCTATTCGAAGACTCGCTCGTAGAGGTGGTGTGAAGCGTATTTCTGGGTTGATTTACGAAGAGAC
TCGTGGTGTTCTGAAGATCTTTTTGGAAAATGTAATTCGTGATTCCGTGACATACACAGAGCACGCTAGGAGAAAGACGGTTACTGCTATGGATG
TTGTTTATGCGCTTAAGAGGCAAGGAAGGACCCTTTACGGATTTGGGGGTTAGGGATTGCCTTAGGATTGATAATTTTATTCTCATCTTTGATGG
TGTAATTTCTCTGTTATACTAATTTAAAGAATAGAGTTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E216784] SGN-U577794 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T2300 [Download] [View] Facility Assigned ID: cC-esflcLEL1O06b1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0175 Quality Trim Threshold: 12.5