SGN ID: SGN-C54421 | Clone name: cLEL-21-M21 |  | Order Clone |
|
Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E217540 | Length: 401 bp (811 bp untrimmed) |
Status: Current Version | Direction: 3' |
>SGN-E217540 [] (trimmed)
AACTAAAATGTAGACTTGTTTGAGCAAAATGTCACAATCTCAATGAAAATTCAAAGCCATAATTGTGTCAAAGTTTAGAGAATTTTATAGCTAAC
TCAAAAAGATCATGTATTAACTAATAAACTCAGTTCCTCAATTGTCAAAATAAGGATAGAGACTTCACTTCTTCTTTTCACCACCACCGGTTGCC
CTCATCTTACGGAGAACGCTGGACATCTCCTCTCTCTTCTTCTTTGCCCTCTTGTGGGTACCCAACTTCCTCTTGGCTACCTTCAATGCACGCTT
GTCCTTACCAACTTTAAGAAGCTCAGTAATCCTCTTCTCATATGGAGCAAATCCAGCAACTTCTCTGATGAGGCTCCTGACGAAGTGGATTCTTT
TGCTGGTTTTCCCTTTTCTGA
[BLAST] [AA Translate]
SGN-ID: SGN-T9852 [Download] [View] |
Facility Assigned ID: cC-esflcLEL21M21a1
|
Submitter: Koni |
Sequencing Facility: Cereon |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 |
Expected Error Rate: 0.0052 |
Quality Trim Threshold: 14.5 |