Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E217548

Search information 
Request: 217548Match: SGN-E217548
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C54443Clone name: cLEL-21-N24
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E217548Length: 433 bp (996 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E217548 [] (trimmed) GGAGACACCTCAAGATAACAACATTAAAGAGCGAGCAAAATAAACCAACAGTTGGACGAGTAGCATTACAGCTTCCAGAAACAAATAAGTAAATT
GTTTAGGAAACTCTATATAGCGCTAGCAACAACGGAAAAGAAAGAAGTCGCAGCAAAATAACAGGATAGTCCATAACTTTAGCTATACAGGTCAT
CATCATCGGCTCCAGCATTAGAAGTTGTGAAGGGATCAGATGCAGCAGCTCCACCACTGGTCTCAGAAAACCGAAATTCCGTTCCAAAACCTCGA
GATTGCTGTAAGGTCTGAGCAAATGCCTGGTATTTACGAATATCGGCATCACTCACACTTCGTCGTGCATACTTCATGGACTCCTCAAAATGAGC
AGGCTTGATCTCTGATATCTCATCATCAGCATCCTCATCCATAGAATCAGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E217548] SGN-U578906 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T9860 [Download] [View] Facility Assigned ID: cC-esflcLEL21N24a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0083 Quality Trim Threshold: 12.5