EST details — SGN-E217693

Search information 
Request: 217693Match: SGN-E217693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55428Clone name: cLEL-25-M19
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C55428 [cLEL-25-M19] Trace: SGN-T11597 EST: SGN-E217653 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E217693Length: 495 bp (890 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E217693 [] (trimmed) ACTATGGCAAAATTTCTTTCACATAAAACAGCATTTGTACACAAAGAAAAATGGAGAACTAAATGAAAAAAATACAACATGCACTTTAAGTCATC
CTTTTTCTATGCTGTCGGAATGAAGGATCCGACTACTTAAACAGACTTCCAAGAGCTCAAACTTCAAATCTGAAAGTTGTTGAAAATGCTTCACG
CCAAGCCACAAACTCTTCCTTGTATTTGACCTGACCCTTGGCAAGACAGGAGTGTACTACTATCTTCGTGTCAATGATAATCAGATCAAATCAGG
GGTGGAGAACCAGTCCAGAAGCAACAAGAACCCTCGAAGAGCTGAAAATTTCCTTTAGAACCATCCTAATGTTGNCAAGTGTATACTCTAGAAGC
TTGATATAGTTCCACTTGGCTTCTCCAGCACTCTTCCGAGAGATTACACTTCAGTCGAAGTGTACAATTAAATTTGTAGATCCTTAAGCGCTTTA
GTTTCTCTATCTACCATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E217693] SGN-U568819 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T11637 [Download] [View] Facility Assigned ID: cC-esflcLEL25M19d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5