Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E218132

Search information 
Request: 218132Match: SGN-E218132
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C54940Clone name: cLEL-23-D7
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C54940 [cLEL-23-D7] Trace: SGN-T10704 EST: SGN-E217912 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218132Length: 241 bp (880 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218132 [] (trimmed) CTAAATGCCCTTGAATTTACTTACTCTTTAGTATTTACCCCAATTGTTGTTTGTAAAAATCAAAAACAGAAATGATTATTATGAAAAAAAAATTA
AGTGAACAAATGGGGTTCTTTTGAATATTTTATATTATGTTATTGTTAAATCCATCGAGCTTTTACAGCTTGTTTGAATACTTGTTACCTATGGT
ATTGTAAGCTATTCGTTTTTGAAATATAATAACTATTTTGTTTTGATTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218132] SGN-U569971 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T10924 [Download] [View] Facility Assigned ID: cC-esflcLEL23D07a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.850 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5