Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E218259

Search information 
Request: 218259Match: SGN-E218259
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C54903Clone name: cLEL-23-B6
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218259Length: 369 bp (813 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218259 [] (trimmed) AGCAGGCCAAAATTATTTCTTTGTAAATTGAGAAATTTACTACACAATCTTCAAAAATTAATTTGTCTATACTGCTTCACATACATAAAATGAAT
TCATGAACATAAAGATTAGGAATTGTTGAGTGTGTACAACAACAATAATTACACTAATAATTTGAGATTGACCATATAAATCTCAGTGACAACTA
CAAAACTATCCCTTTATTACATATTTTTCAGGTGAGGTTGGATGAAACCGATGGTCAATCAATCAGCCTCCTGCAACCCATCCAAAACCACTGAC
CCAACAAACAACCCGACTGCAGTCAACCCGAGGGCTCCAGCCAAAACAGCCTGGGCCGCCACAAGACCCACGGTATCATCGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218259] SGN-U564567 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T11051 [Download] [View] Facility Assigned ID: cC-esflcLEL23B06a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0042 Quality Trim Threshold: 12.5