EST details — SGN-E218682

Search information 
Request: 218682Match: SGN-E218682
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53220Clone name: cLEL-18-P14
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218682Length: 383 bp (561 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218682 [] (trimmed) AGAAGGAAATATACTCAAAATTTCATAAACTTAAATAAGTTGAGCAGTGACCAAGACTGTGTGTAAAGTGATTTAACCCAGGTAAAGGAACAACC
AACAGAGCTATATGTCATTGCCCATCAAGTAATTTGGTCCCGACATAATTGCTCAATTACTCCACTATCCTCAAAAAGAGGCTAGAGAACCATGA
CAATACCTTCTGTAGCCATATCCAAAACTGGCAAAATGCTGTCCAAAACAAAAATGAAAAAAACTGATGCAAATAAACAAAACTATTTCATCCGT
GCTCATCAAATGCACTCTACTTTCCCTTCTTCTGGGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACATTCTTGACAACACCC
ACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218682] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T8114 [Download] [View] Facility Assigned ID: cC-esflcLEL18P14d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5