EST details — SGN-E218847

Search information 
Request: 218847Match: SGN-E218847
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C52883Clone name: cLEL-18-B13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218847Length: 407 bp (562 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218847 [] (trimmed) AGCAAAGGTAACATGTTAACTTAAATGTAACGTAATGAGTAGAAAACTTAAATCTCAAATTAAAGCAACAAAAATCCTGAGCCACCATGGAAAAC
AAACCAAGGCACCTCAACAAAAGCAAATGATAACAGACTCAAAATCATGCTCGCCACCGCCTATCAAGTACCCAGTTCTGAGAATGGATACTTGA
GATACAAGTCAGAGAACTACAACCTAATACACAACTCAAAGACCAAACTAAAGCAGAATTAAATAAAACAGAGTCTAGATAGCACACTCGATGTA
AATAAATAGCATTCGAAACACCAGCATCACACTGCACAGTTCACTTCCCCTTCTTCTGGGCAGCCTTGGTCACCTTGGCACCAGTTGGGTCCTTC
TTGTCAACATTCTTGACAACACCGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218847] SGN-U580418 Tomato 200607 Build 2 320 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T8279 [Download] [View] Facility Assigned ID: cC-esflcLEL18B13d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5