EST details — SGN-E221325

Search information 
Request: 221325Match: SGN-E221325
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C54829Clone name: cLEL-22-O15
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E221325Length: 309 bp (741 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E221325 [] (trimmed) GATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAAGGGAAAATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCA
AACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCCTTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGAC
GAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCAC
CCGAACATGGGCAACTTCCACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E221325] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T10469 [Download] [View] Facility Assigned ID: cC-esflcLEL22O15d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5