Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E222494

Search information 
Request: 222494Match: SGN-E222494
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C52133Clone name: cLEL-16-B8
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E222494Length: 308 bp (861 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E222494 [] (trimmed) AATCTTTTTGAAACAAATATACCCTATTTTGGAGGTCCATAAGCAGCAGCTAATACAATAAATCATTGACCAATGGAAGCAAAATAGAGAAACAA
GGATAAAGAATGATATGAATAAAGCTAATTTGGATACTATTCAATCTTGGGGGTGCACTCAATTCAACAATGTCTAGTTATCCAGTGAATAAAGC
TATTAGTGCTAAGCAATTCATGTGGTTAGAGGTTGACGTACAAATGTCATGTGAAATTCAGCTCAAAACAAAAAGAATCTCTTCCGCGGTGTAGA
TTACTCTTTGTTCTAAGCAGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E222494] SGN-U577600 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T6667 [Download] [View] Facility Assigned ID: cC-esflcLEL16B08d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0053 Quality Trim Threshold: 20.5