Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E222968

Search information 
Request: 222968Match: SGN-E222968
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51419Clone name: cLEL-14-A13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C51419 [cLEL-14-A13] Trace: SGN-T5558 EST: SGN-E223305 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E222968Length: 389 bp (633 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E222968 [] (trimmed) CTAGACGATCCTTTAATTAGGTTCAAACAATTGGATACGAGATGGAAGTCAGCAATAACACAAGTACGAACAACGAAATCAGGATGAAAAGGAAA
AGGAAAAAAATCGTTGCAGGTGAAACAGCAGCCTAAATGGAATCCAAAGCCTGAAGAACATCAGCTTTCACATCTTCAAAATCTTCCACTCCAAA
GCTAAATCGGACCAAGTTATCCAAGATGCCATACTTTGCTCTATCAGACTGGCTAAGATCCCAATAAGACATTATTGCTGGTTGGTCCACAATGC
TCTCACAACCTTCAAACGATGGAGCAATATAAGGAATCCTCAGAGCATCCACAAATTTTGCAGTAGTTAGGAGGTCTCCATCAACCTTAAAACTG
ACCACACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E222968] SGN-U578164 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T5221 [Download] [View] Facility Assigned ID: cC-esflcLEL14A13a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5