EST details — SGN-E223186

Search information 
Request: 223186Match: SGN-E223186
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51708Clone name: cLEL-14-M14
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C51708 [cLEL-14-M14] Trace: SGN-T5929 EST: SGN-E223676 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E223186Length: 345 bp (907 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E223186 [] (trimmed) GTCAATCAAAAAAATACACACGTCTATTCACTAATTTTCCCAAAAGAATATTTATATTTGGCTAGAAGTATCTCACTGGTGAATGAGAAAGGGAA
AAGAACATAATGTAGCACAGATTTAACCTTACAGTAGTAAGTTACATTTAGCTCCATATTACCATCAATGACACTTTTTTCTAACCAGAAAGCAA
AAGCAACTGCAGCCAAAGGTTAGGCCCATCGCCGTCAACTGTACAACATCCTTAATCATTGATATTGCTCTTTTGGAGCAACATGGCTCCTGCTT
TCGGTGACATTGGATTTCACGCCAATGACCTCTGATGCGATTTCCCAGCTCCCACTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E223186] SGN-U575123 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T5439 [Download] [View] Facility Assigned ID: cC-esflcLEL14M14d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0032 Quality Trim Threshold: 12.5