EST details — SGN-E223628

Search information 
Request: 223628Match: SGN-E223628
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C51709Clone name: cLEL-14-M15
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C51709 [cLEL-14-M15] Trace: SGN-T5535 EST: SGN-E223282 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E223628Length: 450 bp (592 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E223628 [] (trimmed) TTTTTTTTCAAAACAATGTTAATAGCAAATCAACTTGTTGGACAATCTAAATCAGTATGTTCAGGCACATTACACAACAACATTTAGCAGACGCA
AAGACGAAAAATCATCATACTAGTGTTACATAATAGATTATACATATTTAAAACGAACTGAGATGATTTTTGCACATTCGTACACCCCTAAACCA
TACTTCGGATCACAAATATACATCTCGGCCTATAATCAAACGGACAACTGCAGGTTTGATGCTTTCCAGTTATAGTCAGTCAAGACTAACAGTAC
TGAACCTTATGTTGTGCATTTTTTGAACTTGGAAGACGTTGATAAACAATCTACATCTCCTTCCTTCAGCTAATGCTTTTAGCAATCACAAGATA
GAGCAGGCTTTCTGACCCTTTCTCTTCTTCTTTCTTCTTTTGCTTGGTGGTTGTAGGACCACCTTAATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E223628] SGN-U578524 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T5881 [Download] [View] Facility Assigned ID: cC-esflcLEL14M15d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5