EST details — SGN-E225142

Search information 
Request: 225142Match: SGN-E225142
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C52523Clone name: cLEL-17-C13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C52523 [cLEL-17-C13] Trace: SGN-T7408 EST: SGN-E225540 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E225142Length: 327 bp (824 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E225142 [] (trimmed) TTTTTTTTTACAGAATTGTTATCATCAAATTTATTCTCAATCTCGATTAAATCGATATAGAAAGAATTCATACGAGTGTGATATTATTTTCTTAA
GCTAATGGGACTTCCCACTCAGTTTTACACATCAAACATGTAGATAACAAAACTACTGTTGTTCTCAAATTATAACAAAAATGTCTTATTCATAG
ACTTTGCATTCCTCATCAGAAGGATTTGTCTCACAGAACTCATCCAATGGGTCTCCACTTCCTGGTGCTGCAACACCTGGCCATTTGCTTGCTAC
TAGATGAGCCAAGTCCACAACTCTTTGGCTGTATCCTCGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E225142] SGN-U578628 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T7010 [Download] [View] Facility Assigned ID: cC-esflcLEL17C13d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0016 Quality Trim Threshold: 12.5