Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E225568

Search information 
Request: 225568Match: SGN-E225568
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C52579Clone name: cLEL-17-E20
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C52579 [cLEL-17-E20] Trace: SGN-T7024 EST: SGN-E225156 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E225568Length: 390 bp (917 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E225568 [] (trimmed) GGGGCTGCCACTAAAAATATTACTCCATATATCAAACCAAACAGAGTCAGTTCGCATTACTTGCGAAGATCTTATTTATTATATATATACAATCT
TTAAGCATCAAGAGGTCCGTCCTATCTTAACACATACACTGTAGAATAGCCTTTCTGAGTTTCCATGTTTTGAGTGTCATATTACTATAAAATTG
AATCTTCCCATACTATGCTTATACCTCTTCACACAGAGGCCAAACTGCGAATACTAGTGAAAGGGGAGTAAGATCGGTTTTCTAAAACCCAAACT
TAGGACCCAGTCTTCTTTTCCTGAGGCGCTCCGCAATAATAAAGGCAAGTTCAAGTGCTTGAGAAGCATTGAGTCTTGGGTCACAATGTGTATGA
TAGCGCGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E225568] SGN-U566920 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T7436 [Download] [View] Facility Assigned ID: cC-esflcLEL17E20a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5