EST details — SGN-E225815

Search information 
Request: 225815Match: SGN-E225815
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C52524Clone name: cLEL-17-C14
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E225815Length: 396 bp (951 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E225815 [] (trimmed) ATACGAGTGTGATATTATTTTCTTAAGCTAATGGGACTTCCCACTCAGTTTTACACATCAAACATGTAGATAACAAAACTACTGTTGTTCTCAAA
TTATAACAAAAATGTCTTATTCATAGACTTTGCATTCCTCATCAGAAGGATTTGTCTCACAGAACTCATCCAATGGGTCTCCACTTCCTGGTGCT
GCAACACCTGGCCATTTGCTTGCTACTAGATGAGCCAAGTCCACAACTCTTTGGCTGTATCCCCACTCGTTGTCATACCAAGCAACGACCTTGAC
CATATCATCTCCCATGACCATGGTCAAGGAGGAGTCGATGGTGGATGAAACGTCAGAGCATCGGAAGTCAACTGAAACAAGAGGGGCATCACACA
CATCTAATATGCCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E225815] SGN-U578628 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T7683 [Download] [View] Facility Assigned ID: cC-esflcLEL17C14a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5