EST details — SGN-E226447

Search information 
Request: 226447Match: SGN-E226447
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55448Clone name: cLEL-26-A10
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C55448 [cLEL-26-A10] Trace: SGN-T11794 EST: SGN-E226374 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E226447Length: 376 bp (981 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E226447 [] (trimmed) TTTTTTTTAGTAAATTGAACTTGTATTTAATATGATTTCTTCAGGTAACAATACCATACAAAATAAATAATAACTTTTCAAGTGTCTAACCAAAA
ATATAGTAAAACATGGAAGAACACTACAAGAAAGCTAACTAGCGAAAAGCATAATGAAGCAGGGTACAGGGAGGAGAAACCTATATAAATTAGTA
AAATTAATACAGAAGAAACCTTACTGAAGTCCCATACATTTTCTTCACTATACCAAAATTTTGAACGCAGCCTTGGACAAACTCTTGTATTGCCA
GCTATCAAAAAAATTATGTCGCCATTCCTTACCATCTGCGACCAAAGTTGCCATTACCTCTCCCCCCTCTTTCTCCAGAAAAAGCCACCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E226447] SGN-U578400 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T11867 [Download] [View] Facility Assigned ID: cC-esflcLEL26A10d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5