Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E226630

Search information 
Request: 226630Match: SGN-E226630
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55814Clone name: cLEL-26-P17
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C55814 [cLEL-26-P17] Trace: SGN-T12369 EST: SGN-E226949 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E226630Length: 341 bp (1017 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E226630 [] (trimmed) CCATCTAAATTTTGTCTAGTTTTCAAACCATCCACTCAAATTTAAGAAACCAGCAAAGCTAACACAGCCCATGTTTTTTTATGGTTAATGATCGG
CAAAAACTAGTACAACATCCACTGAAAAGCAGCACTACAGTCATGTATTATGAATGGTTCAACCCCAATTCAAAAGGCGTCAAATGATAAATACA
TAGAAAACAAGGCTCAGCAGCTCCAATATAACTTTATTCTAAGACAGACACCACCGCTAGTTGCTGAATCTTCACCTCACCGGAGCAGTTAACCC
TGGAGGCCAATAATACCACAAGCAATCCTTCCGCCAGCATTTCCGGTGCTTTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E226630] SGN-U581590 Tomato 200607 Build 2 168 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T12050 [Download] [View] Facility Assigned ID: cC-esflcLEL26P17d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5