EST details — SGN-E226817

Search information 
Request: 226817Match: SGN-E226817
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C55568Clone name: cLEL-26-F10
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E226817Length: 317 bp (928 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E226817 [] (trimmed) AAAGCAATACAATACAATCATGTCCTTTCACTGGTAAAATAACAGTTATGTTCAAAGCAAAACTGAAGGCAATTACATACACTAATAACAAGGGC
TATGCTACAAAACCTATCAAGACTACTGAATTAACTGAAAAATGCAGAAGTTAAGTGAATGATATTTACATGTGCTAGCTCCAAATGAATGACAG
ACGAAACAACAGGGTTGGAATTGACCTTGTAACTATGTCGGTGCTGCTAATGCTCATCATCGGTTTCTTGTTTCTTGACCAAAGACCAGTTGTGT
TGCACACTTACTTTATATTCACTGCTATCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E226817] SGN-U573946 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T12237 [Download] [View] Facility Assigned ID: cC-esflcLEL26F10d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0220 Quality Trim Threshold: 14.5