Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E226966

Search information 
Request: 226966Match: SGN-E226966
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17568Clone name: cLED-1-C9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17568 [cLED-1-C9] Trace: SGN-T48477 EST: SGN-E226965 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E226966Length: 543 bp (801 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E226966 [] (trimmed) GAGTAAGAAAAATAAATTCATCCGCAAATGTTAATAATGAAGGGTAATTACAAATTTCGAAAAGAAAAAAAAGAATTTTAAAGTCACTAATAATT
AGGTCCTTCACTCATTAATCCGACCGACAAAGTGCATCAAGTTGATGATAGTCGTGGTCTAATGACCAATCTTCCCACCCGTAGCCCCTAGCCCG
TGCCCGTGCCCGCTCTAAATGGAATGAATTTCTTAGTTACGCTACACTCCAACCCGAGTCCCCATAGCGTTTTTCTTGTATTGGTTGCTCCATAT
AAACAGTCAGAGTCAATAAACCATTAAGAAAGGTATTGTTAATGTCAGACCAATGAATATGCCATTCATAAGATGAGGTAACAAGGGAAAACACC
AGTCTAACAGTTGTAGGAATGAACCAATTGATTGAATGTCTCACCAGAGTCCACACCATAAGAGTTTGTATAACCTTGGCCACCAAACGAGCCTT
ACATCGATCAAGAGAGTCATCAATTTTCTACTTAACCTGACAACAGTGTTATCAAAAGCGAAAAGCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E226966] SGN-U582320 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48478 [Download] [View] Facility Assigned ID: TOVAA17TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5